choleraeO1 nqrA-Fmutant might be caused by a combination of multiple factors. and a succinate dehydrogenase (SDH) inhibitor, thenoyltrifluoroacetone (TTFA), strongly inhibited CT production in both classical and El Tor biotype strains ofV. cholerae. Accordingly, we propose the main respiratory enzyme ofV. cholerae, as a potential drug target to treat cholera because human mitochondria do not contain Na+-NQR orthologs. Keywords:anti-virulence drug,Vibrio cholerae, Na+-NQR, electron transport chain, cholera toxin == 1. Introduction == Vibrio choleraeis the etiological agent of cholera, a life-threatening diarrheal disease. Toxin-coregulated pilus (TCP) and cholera toxin (CT) are crucial determinants of the pathogenicity ofV. cholerae. TCP is usually a Type IV pilus that is required for colonization in the small intestine [1], whereas CT is usually a secreted enterotoxin responsible for inducing severe watery diarrhea, a hallmark feature of cholera [2]. The expression levels of TCP and CT are positively regulated by an AraC-type transcriptional regulator, ToxT [3]. The sodium-translocating NADHubiquinone oxidoreductase (Na+-NQR) is usually a unique redox-driven sodium pump and is found in the electron transport chain (ETC) of a number of pathogenic and marine bacteria [4]. Na+-NQR is usually predicted to play a vital role in the ETC of these organisms, includingV. cholerae, that do not possess an ortholog of the mitochondrial Complex I, which is typically the main ETC-linked NADH-dehydrogenase (http://gsc.jcvi.org/projects/msc/vibrio/). It is well known that this genes encoding NQR are strongly repressed at anaerobic conditions [5,6]. Since some parts of the small intestine are anaerobic, one might speculate that lack of Na+-NQR does not affectV. choleraeO1 virulence. However, a previous study revealed that Na+-NQR is essential forV. choleraeO1 colonization in the small intestine of mice and in acid tolerance response (ATR) [7]. This suggested that Na+-NQR is essential forV. choleraeO1 virulence and could be used as a molecular target to develop new therapeutic treatments for cholera. In PIK3CA this study, we further aimed to examine the link between Na+-NQR and virulence factor production as a first step to evaluate Na+-NQR as a molecular target for anti-cholera drug development. == 2. Materials and Methods == == 2.1. Bacterial strains, plasmids and media == V. choleraeO1 classical biotype strains, O395N1 and CA401, their nqrA-Fmutant strains, and El Tor AM 2233 biotype strain, N16961, were used in this study. The nhaAmutant, the nhaBmutant and the mrpA-Fmutant strains ofV. choleraeO395N1 (Quinn et. al. unpublished) were also used in this study. All bacterial strains were kept at 80C in 20% glycerol stocks. The classical biotype strains were grown overnight in Luria-Bertani (LB) medium (Difco) at 37C, washed, diluted to OD600= 0.05 in LB (initial pH 6.5), and grown at 30C. The pH of the LB medium was adjusted to pH 6.5 with HCl. The El Tor biotype strain, N16961, was produced overnight in LB medium at 37C and then grown in Yeast Extract Peptone water (YEP) as described previously (i.e., AKI growth conditions) [8]. HQNO and TTFA were added at 2.5 M. L-lactate was added at 40 mM. L-lactate was also added to the pre-cultures to induce L-lactate dehydrogenase activity. Streptomycin was supplemented at 100 g/ml. == 2.2 Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis == Cells ofV. choleraeO1 produced in LB (initial pH 6.5) at 30C for 2, 4, 6, and 8 hours were treated with RNA Protect Bacteria Reagent (Qiagen). RNA was extracted using the QIAGEN RNeasy Mini Kit (Qiagen) and treated with TURBO DNA-free Kit (Invitrogen). AM 2233 Primers used for qRT-PCR are 5Vc16SrRNAqRT: GATCATGGCTCAGATTGAACG, 3Vc16SrRNAqRT: TCGCCACCCAAGGAACA, 5VcToxTqRT: GCTGTCCTTTCTGAAGTGGTAAATG, 3VCToxTqRT: TTCTACTTTCGAGAAGAACCCTGAA, 5VcCtxBqRT: AGCGATTGAAAGGATGAAGGA, 3VcCtxBqRT: CGCATGAGGCGTTTTATTATTC, 5VcTcpAqRT: CGTAATGCAGCAGCTAATAAAGCA, 3VcTcpAqRT: GGAACATATCACCGACACTGGTAA. Real-time qRT-PCR reactions were performed using the SuperScriptIII PlatinumSYBRGreen One-Step qRT-PCR Kit (Invitrogen) and an ABI PRISM 7500 FAST Sequence Detection System (Applied Biosystems) at the Center for Genome Research and Biocomputing Core Laboratory at Oregon State University. == 2.3 Measurements of CT production == CT production was determined by GM1-based enzyme linked immunosorbent assays (CT-ELISA) essentially as described [9]. In brief, CT-ELISA was performed using a cholera toxin-specific monoclonal antibody (Abcam) and Goat-Anti-Mouse (GAM)-HRP Conjugated antibodies (Bio-Rad). An HRP Substrate kit (Bio-Rad) was used to detect the HRP activity and the plates were read at 415 nm on an iMark microplate reader (Bio-Rad). The amount of CT was quantified using known amounts of purified cholera toxin B subunit (Sigma) as the standard. == 3. Results == == 3.1 Growth phase dependent effects of Na+-NQR ontoxTexpression and cholera toxin production == Because we previously reported that Na+-NQR affectstoxTtranscription [10], we monitored the growth and virulence gene expressions usingV. choleraeparent and isogenic O395N1nqrA-Fmutant strains AM 2233 cultured under conditions typically used forin vitroinduction of virulence gene expression [LB (initial pH 6.5) at 30C] [9]..